|
Complete Genomics Inc
cpas barcode primer 3 kit Cpas Barcode Primer 3 Kit, supplied by Complete Genomics Inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/cpas barcode primer 3 kit/product/Complete Genomics Inc Average 97 stars, based on 1 article reviews
cpas barcode primer 3 kit - by Bioz Stars,
2026-05
97/100 stars
|
Buy from Supplier |
|
Sangon Biotech
primer cd44 r sequence 5 cattgtgggcaaggtgctatt 3 Primer Cd44 R Sequence 5 Cattgtgggcaaggtgctatt 3, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer cd44 r sequence 5 cattgtgggcaaggtgctatt 3/product/Sangon Biotech Average 86 stars, based on 1 article reviews
primer cd44 r sequence 5 cattgtgggcaaggtgctatt 3 - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
primer krt15 r sequence 5 ccagggcacgtaccttgtc 3 Primer Krt15 R Sequence 5 Ccagggcacgtaccttgtc 3, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer krt15 r sequence 5 ccagggcacgtaccttgtc 3/product/Sangon Biotech Average 86 stars, based on 1 article reviews
primer krt15 r sequence 5 ccagggcacgtaccttgtc 3 - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
primer cd44 f sequence 5 ctgccgctttgcaggtgta 3 Primer Cd44 F Sequence 5 Ctgccgctttgcaggtgta 3, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer cd44 f sequence 5 ctgccgctttgcaggtgta 3/product/Sangon Biotech Average 86 stars, based on 1 article reviews
primer cd44 f sequence 5 ctgccgctttgcaggtgta 3 - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
primer krt15 f sequence 5 tctgctaggtttgtctcttcagg 3 Primer Krt15 F Sequence 5 Tctgctaggtttgtctcttcagg 3, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer krt15 f sequence 5 tctgctaggtttgtctcttcagg 3/product/Sangon Biotech Average 86 stars, based on 1 article reviews
primer krt15 f sequence 5 tctgctaggtttgtctcttcagg 3 - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
primer β actin r sequence 5 gtagtttcgtggatgccaca 3 Primer β Actin R Sequence 5 Gtagtttcgtggatgccaca 3, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer β actin r sequence 5 gtagtttcgtggatgccaca 3/product/Sangon Biotech Average 86 stars, based on 1 article reviews
primer β actin r sequence 5 gtagtttcgtggatgccaca 3 - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
primer β actin f sequence 5 tccctggagaagagctacg 3 Primer β Actin F Sequence 5 Tccctggagaagagctacg 3, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer β actin f sequence 5 tccctggagaagagctacg 3/product/Sangon Biotech Average 86 stars, based on 1 article reviews
primer β actin f sequence 5 tccctggagaagagctacg 3 - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
glyceraldehyde 3 phosphate dehydrogenase gapdh primers Glyceraldehyde 3 Phosphate Dehydrogenase Gapdh Primers, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/glyceraldehyde 3 phosphate dehydrogenase gapdh primers/product/Sangon Biotech Average 86 stars, based on 1 article reviews
glyceraldehyde 3 phosphate dehydrogenase gapdh primers - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
primer 3 software Primer 3 Software, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer 3 software/product/Sangon Biotech Average 86 stars, based on 1 article reviews
primer 3 software - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |